Plannedexperiment Resource

Resource URL: http://mytorrentserver/rundb/api/v1/plannedexperiment/

Schema URL: http://mytorrentserver/rundb/api/v1/plannedexperiment/schema/

Perform CRUD operations on plannedexperiment resources and data elements.

Even though plannedExperiment db schema has changed dramatically in TSS 3.6 as part of the “plan data decentralization” (aka PDD) effort. A facade is provided so if you are already familiar with using the plan REST API, changes under the hood are abstracted from the REST API users. However, note that “selectedPlugins” and “barcodedSamples” are JSON fields and their data structures tend to change from release to release.

What has changed in TSS 4.2

  • The JSON data structure in barcodedSamples has been changed with the following added
  • controlSequenceType
  • hotSpotRegionBedFile
  • nucleotideType
  • reference
  • targetRegionBedFile
  • The JSON data structure in selectedPlugins for IonReporter has been changed with the following added
  • NucleotideType
  • cancerType
  • cellularityPct
  • New VariantCaller parameters have been added and some parameters have been obsolete (persisted in selectedPlugins)
  • New values for runType, applicationGroup and sampleGrouping have been added to support DNA and Fusions
  • Some new attributes intended for internal use only have been added to plannedExperiment.
  • We have started enforcing validation during REST API posting for
  • barcodeId
  • chipType
  • flows
  • notes
  • planName
  • project or projects
  • runType
  • sampleTubeLabel
  • sample or sample in barcodedSamples
  • sampleGroupingName
  • sequencekitname
  • templateKitName
  • Posting that fails validation will receive an error code.
  • Until stringent validation is fully in place during non-GUI REST API posting, please do your due diligence to ensure the data and data format posted are valid.

Moreover, some attributes require “internal” value instead of the “customer-facing” value to be persisted (e.g., sequencekitname, chipType). Please refer to the Comment/Expected Value column more details.

Validation Rules

RULE-1: Valid characters: letters, numbers, dashes, underscores, dots

RULE-2: Valid characters: letters, numbers, spaces, dashes, underscores, dots

RULE-3: Invalid leading characters: dashes, underscores, dots

Field Notes

Attribute Name Required/Optional/Nullable Data type Default value Valid values Example Comment/Expected Value
adapter Opt/Nullable varchar(256)       Not really being used
applicationGroupDisplayedNamne Opt/Nullable     DNA, DNA and Fusions, Metagenomics, RNA, Typing    
autoAnalyze   Boolean TRUE      
autoName Opt/Nullable varchar(512)       Not really being used
barcodeId Opt/Nullable varchar(128)     IonSet1 rundb_dnabarcode.name
barcodedSamples Opt/Nullable json     refer to example below  
base_recalibrate Opt Boolean       whether to recalibrate signal measurements for homo-polymers
bedfile Opt/Nullable varchar(1024)     /results/uploads/BED/71/hg19/unmerged/detail/CFTRexon.20131001.designed.bed target region BED file rundb_content.path
chipBarcode Opt/Nullable varchar(64)        
chipType Opt varchar(32)     318v2 rundb_chip.name Even though REST API posting will allow you to create a plan without specifying the chipType, TS UI will require chipType to be specified.
controlSequencekitname Opt/Nullable varchar(512)       rundb_kitInfo.name
cycles Opt/Nullable int        
date Opt/Nullable DateTimeField        
expName Opt varchar(128)       Do not set the value manually. Crawler will set it during explog processing
flows Req int 0   500  
flowsInOrder Opt/Nullable varchar(512)       Do not set the value manually
forward3primeadapter Req varchar(512)     ATCACCGACTGCCCATAGAGAGGCTGAGAC  
id Opt int       Do not set this value unless you are updating a plan
irworkflow Opt varchar(1024)       TSS 2.4/IonReporter-related; no longer being used
isDuplicateReads Opt Boolean       Whether to filter out PCR duplicates
isFavorite Opt Boolean FALSE      
isPlanGroup Opt Boolean FALSE      
isReusable Opt Boolean FALSE      
isReverseRun Req Boolean FALSE True,False    
isSystem Opt Boolean FALSE      
isSystemDefault Opt Boolean FALSE      
libkit Opt/Nullable varchar(512)     Ion Xpress Plus Fragment Library Kit rundb_kitInfo.name
library Opt/Nullable varchar(512)     hg19 rundb_referencegenome.short_name
libraryKey Req varchar(64)     TCAG  
librarykitname Opt/Nullable varchar(512)     Ion AmpliSeq 2.0 Library Kit rundb_kitInfo.name
metaData Opt json        
notes Opt/Nullable varchar(1024)       see RULE-2
pairedEndLibraryAdapterName Opt/Nullable varchar(512)       Since paired-end sequencing has been dis-continued, do not use.
parentPlan Opt/Nullable FK       Currently used for paired-end plans only. Since PE plans have been dis-continued, do not use.
planDisplayedName   varchar(512)     demo plan see RULE-2 REST API posting does not support this attribute yet. Use planName instead.
planExecuted Opt Boolean FALSE True,False    
planExecutedDate Opt/Nullable DateTimeField        
planGUID Opt/Nullable varchar( 512)       Do not set a value manually during plan creation
planName   varchar(512)     demo_plan see RULE-1
planPGM Opt/Nullable varchar(128)       Not being used
platform Opt varchar(128) “” “”, PGM, PROTON    
planShortID Opt/Nullable         Do not set a value manually during plan creation
planStatus   varchar(512) planned “”, pending, reserved, planned, run   see planStatus state diagrams below For OneTouch & IonChef
preAnalysis Opt Boolean        
projects Opt varchar(64) for each project name     [“project1”,”project2”] see RULE-1 a list of comma separated project names
realign Opt Boolean       whether to run an optional analysis step to adjust the alignment, primarily in the CIGAR string
regionfile Opt/Nullable varchar(1024)     /results/uploads/BED/71/hg19/unmerged/detail/CFTRexon.20131125.hotspots.bed hotspot region BED file
reverse_primer Opt/Nullable varchar(128)        
runMode Opt varchar(64)   “”,”single”, single  
runType Req varchar(512) GENS “AMPS”, “AMPS_DNA_RNA”, “AMPS_EXOME”, “AMPS_RNA”, “GENS”, “RNA”, “TAR”, “WGNM”, “TARS_16S”   rundb_runtype.runType
runName Opt/Nullable varchar(255)       Not being used
sample Required for plan varchar(127)     demo_sample see RULE-1, RULE-3
sampleDisplayedName Opt/Nullable varchar(127)     demo sample see RULE-2, RULE-3 REST API posting does not support this attribute yet. Use sample instead.
sampleGroupingName Opt/Nullable     DNA_RNA, Other, Sample_Control, Self, Tumor_Normal Self  
samplePrepKitName Opt/Nullable varchar(512)     Ion TargetSeq(tm) Custom Enrichment Kit (100kb-500kb) rundb_kitInfo.name
sampleTubeLabel Opt/Nullable varchar(512)     X12450aab The barcode on the tube that contains the sample genetic material for sequencing
selectedPlugins Opt/Nullable json     refer to example below Since plugin configuration parameters are stored with the selected plugins, it can get complicated fast. It is not advised to manually post the selectedPlugins json blob.
seqKitBarcode Opt/Nullable varchar(64)       Not really being used
sequencekitname Recommend to set varchar(512)     IonPGM200Kit-v2 rundb_kitInfo.name
storageHost Opt/Nullable varchar(128)        
storage_options Opt varchar(200) A “KI”,”A”,”D”    
templatingKitName Opt/Nullable varchar(512)     Ion PGM Template OT2 200 Kit for either OneTouch or IonChef rundb_kitInfo.name
usePostBeadfind Opt Boolean        
usePreBeadfind Opt Boolean TRUE      
username Opt/Nullable varchar(128)     ionuser the user currently logs in to Torrent Browser for this GUI-based plan creation. For REST API posting, this is just treated as freeform text auth_user.username

PlanStatus state transition

OneTouch

../_images/ot_state.png

IonChef

../_images/ic_state.png

barcodedSamples JSON Examples

Generic sequencing plan

"barcodedSamples": {
    "s 1": {
        "barcodeSampleInfo": {
            "IonSet1_16": {
                "controlSequenceType": "",
                "description": "desc 1",
                "externalId": "accession 101",
                "hotSpotRegionBedFile": "/results/uploads/BED/19/hg19/unmerged/detail/4477685_CCP_hotspots_20121225.bed",
                "nucleotideType": "DNA",
                "reference": "hg19",
                "targetRegionBedFile": "/results/uploads/BED/19/hg19/unmerged/detail/4477685_CCP_designed.bed"
            }
        },
        "barcodes": [
            "IonSet1_16"
        ]
    },
    "s 2": {
        "barcodeSampleInfo": {
            "IonSet1_12": {
                "controlSequenceType": "",
                "description": "desc 2",
                "externalId": "accession 80",
                "hotSpotRegionBedFile": "/results/uploads/BED/19/hg19/unmerged/detail/4477685_CCP_hotspots_20121225.bed",
                "nucleotideType": "DNA",
                "reference": "hg19",
                "targetRegionBedFile": "/results/uploads/BED/19/hg19/unmerged/detail/4477685_CCP_designed.bed"
            }
        },
        "barcodes": [
            "IonSet1_12"
        ]
    },
    "s 3": {
        "barcodeSampleInfo": {
            "IonSet1_15": {
                "controlSequenceType": "",
                "description": "desc 3",
                "externalId": "accession 280",
                "hotSpotRegionBedFile": "/results/uploads/BED/19/hg19/unmerged/detail/4477685_CCP_hotspots_20121225.bed",
                "nucleotideType": "DNA",
                "reference": "hg19",
                "targetRegionBedFile": "/results/uploads/BED/19/hg19/unmerged/detail/4477685_CCP_designed.bed"
            }
        },
        "barcodes": [
            "IonSet1_15"
        ]
    }
},

Onconet DNA plan

"barcodedSamples": {
    "example 1": {
        "barcodeSampleInfo": {
            "IonXpress_010": {
                "controlSequenceType": "",
                "description": "example here",
                "externalId": "id 1",
                "hotSpotRegionBedFile": "/results/uploads/BED/22/hg19/unmerged/detail/ColonLung.20131001.hotspots.bed",
                "nucleotideType": "DNA",
                "reference": "hg19",
                "targetRegionBedFile": "/results/uploads/BED/22/hg19/unmerged/detail/ColonLung.20131001.designed.bed"
            }
        },
        "barcodes": [
            "IonXpress_010"
        ]
    },
    "example 2": {
        "barcodeSampleInfo": {
            "IonXpress_005": {
                "controlSequenceType": "",
                "description": "another example here",
                "externalId": "id 2",
                "hotSpotRegionBedFile": "/results/uploads/BED/22/hg19/unmerged/detail/ColonLung.20131001.hotspots.bed",
                "nucleotideType": "DNA",
                "reference": "hg19",
                "targetRegionBedFile": "/results/uploads/BED/22/hg19/unmerged/detail/ColonLung.20131001.designed.bed"
            }
        },
        "barcodes": [
            "IonXpress_005"
        ]
    }
},

Onconet DNA and Fusions plan

"barcodedSamples": {
    "s 1": {
        "barcodeSampleInfo": {
            "IonXpress_001": {
                "controlSequenceType": "",
                "description": "description here",
                "externalId": "ext 1",
                "hotSpotRegionBedFile": "/results/uploads/BED/22/hg19/unmerged/detail/ColonLung.20131001.hotspots.bed",
                "nucleotideType": "DNA",
                "reference": "hg19",
                "targetRegionBedFile": "/results/uploads/BED/22/hg19/unmerged/detail/ColonLung.20131001.designed.bed"
            },
            "IonXpress_002": {
                "controlSequenceType": "",
                "description": "description here",
                "externalId": "ext 1",
                "hotSpotRegionBedFile": "",
                "nucleotideType": "RNA",
                "reference": "hg19_rna",
                "targetRegionBedFile": ""
            }
        },
        "barcodes": [
            "IonXpress_001",
            "IonXpress_002"
        ]
    }
}

selectedPlugins JSON Examples

IonReporterUploader, coverageAnalysis, sampleId and variantCaller

"selectedPlugins": {
    "IonReporterUploader": {
        "features": [
            "export"
        ],
        "id": 700,
        "name": "IonReporterUploader",
        "userInput": {
            "accountId": "1234567890abcde",
            "accountName": " demo IonReporter (Version: 4.2 | User: Ion User | Org: IR Org)",
            "userInputInfo": [{
                "ApplicationType": "Low-Coverage Whole Genome Sequencing",
                "Gender": "Female",
                "NucleotideType": "DNA",
                "Relation": "Self",
                "RelationRole": "Self",
                "Workflow": "Test_WK_1",
                "barcodeId": "IonXpress_010",
                "cancerType": "Breast Cancer",
                "cellularityPct": "23",
                "sample": "example 1",
                "sampleDescription": "example here",
                "sampleExternalId": "id 1",
                "sampleName": "example_1",
                "setid": "1__4c310e03-d188-4702-b82a-f9043bc04350"
            }, {
                "ApplicationType": "Low-Coverage Whole Genome Sequencing",
                "Gender": "Male",
                "NucleotideType": "DNA",
                "Relation": "",
                "RelationRole": "Self",
                "Workflow": "Test_WK_1",
                "barcodeId": "IonXpress_005",
                "cancerType": "Liver Cancer",
                "cellularityPct": "27",
                "sample": "example 2",
                "sampleDescription": "another example here",
                "sampleExternalId": "id 2",
                "sampleName": "example_2",
                "setid": "2__4c310e03-d188-4702-b82a-f9043bc04350"
            }]
        },
        "version": "4.2-r88003"
    },
    "coverageAnalysis": {
        "features": [],
        "id": 696,
        "name": "coverageAnalysis",
        "userInput": "",
        "version": "4.2-r87890"
    },
    "sampleID": {
        "features": [],
        "id": 701,
        "name": "sampleID",
        "userInput": "",
        "version": "4.2-r87942"
    },
    "variantCaller": {
        "features": [],
        "id": 699,
        "name": "variantCaller",
        "userInput": {
            "freebayes": {
                "allow_complex": "0",
                "allow_indels": "1",
                "allow_mnps": "0",
                "allow_snps": "1",
                "gen_min_alt_allele_freq": "0.03",
                "gen_min_coverage": "6",
                "gen_min_indel_alt_allele_freq": "0.1",
                "min_base_qv": "2",
                "min_mapping_qv": "4",
                "read_max_mismatch_fraction": "1.0",
                "read_mismatch_limit": "10"
            },
            "long_indel_assembler": {
                "kmer_len": "19",
                "max_hp_length": "8",
                "min_indel_size": "4",
                "min_var_count": "5",
                "min_var_freq": "0.15",
                "relative_strand_bias": "0.8",
                "short_suffix_match": "5"
            },
            "meta": {
                "built_in": true,
                "compatibility": {
                    "chip": [
                        "pgm",
                        "proton_p1"
                    ],
                    "library": [
                        "ampliseq"
                    ],
                    "panel": "/rundb/api/v1/contentupload/22/"
                },
                "configuration": "",
                "librarytype": "ampliseq",
                "name": "Panel-optimized - Colon and Lung Panel - 10/7/2013",
                "repository_id": "",
                "tooltip": "Panel-optimized parameters from AmpliSeq.com",
                "trimreads": true,
                "ts_version": "4.0",
                "tvcargs": "tvc",
                "user_selections": {
                    "chip": "pgm",
                    "frequency": "germline",
                    "library": "ampliseq",
                    "panel": "/rundb/api/v1/contentupload/22/"
                }
            },
            "torrent_variant_caller": {
                "data_quality_stringency": "6.5",
                "downsample_to_coverage": "10000",
                "filter_deletion_predictions": "0.2",
                "filter_insertion_predictions": "0.2",
                "filter_unusual_predictions": "0.3",
                "heavy_tailed": "3",
                "hotspot_beta_bias": "100.0",
                "hotspot_min_allele_freq": "0.01",
                "hotspot_min_cov_each_strand": "2",
                "hotspot_min_coverage": "6",
                "hotspot_min_variant_score": "6",
                "hotspot_strand_bias": "0.95",
                "hp_max_length": "8",
                "indel_beta_bias": "10.0",
                "indel_min_allele_freq": "0.05",
                "indel_min_cov_each_strand": "2",
                "indel_min_coverage": "15",
                "indel_min_variant_score": "6",
                "indel_strand_bias": "0.9",
                "outlier_probability": "0.01",
                "prediction_precision": "1.0",
                "snp_beta_bias": "100.0",
                "snp_min_allele_freq": "0.02",
                "snp_min_cov_each_strand": "0",
                "snp_min_coverage": "6",
                "snp_min_variant_score": "6",
                "snp_strand_bias": "0.95"
            }
            bbb
        },
        "version": "4.2-r87667"
    }
},
"seqKitBarcode": null,
"sequencekitname": "IonPGM200Kit-v2",
"storageHost": null,
"storage_options": "A",
"templatingKitBarcode": null,
"templatingKitName": "Ion PGM Template OT2 200 Kit",
"tfKey": "ATCG",
"thumbnailalignmentargs": "",
"thumbnailanalysisargs": "",
"thumbnailbasecallerargs": "",
"thumbnailbeadfindargs": "",
"thumbnailcalibrateargs": "",
"usePostBeadfind": true,
"usePreBeadfind": true,
"username": "ionadmin",
"variantfrequency": ""
},

IonReporterUploader selected for a Onconet DNA and Fusions plan

"selectedPlugins": {
    "IonReporterUploader": {
        "features": [
            "export"
        ],
        "id": 700,
        "name": "IonReporterUploader",
        "userInput": {
            "accountId": "1234567890abcde ",
            "accountName": "demo IonReporter (Version: 4.2 | User: Ion User | Org: IR Org)",
            "userInputInfo": [{
                "ApplicationType": "Oncomine_DNA_RNA_Fusion",
                "Gender": "Male",
                "NucleotideType": "DNA",
                "Relation": "DNA_RNA",
                "RelationRole": "Self",
                "Workflow": "AmpliSeq Colon Lung v2 with RNA Lung Fusion single sample",
                "barcodeId": "IonXpress_001",
                "cancerType": "Colorectal Cancer",
                "cellularityPct": "17",
                "sample": "s 1",
                "sampleDescription": "description here",
                "sampleExternalId": "ext 1",
                "sampleName": "s_1",
                "setid": "1__381a5a84-5af0-40ff-84c1-b31720fea6ca"
            }, {
                "ApplicationType": "Oncomine_DNA_RNA_Fusion",
                "Gender": "Male",
                "NucleotideType": "RNA",
                "Relation": "DNA_RNA",
                "RelationRole": "Self",
                "Workflow": "AmpliSeq Colon Lung v2 with RNA Lung Fusion single sample",
                "barcodeId": "IonXpress_002",
                "cancerType": "Colorectal Cancer",
                "cellularityPct": "17",
                "sample": "s 1",
                "sampleDescription": "description here",
                "sampleExternalId": "ext 1",
                "sampleName": "s_1",
                "setid": "1__381a5a84-5af0-40ff-84c1-b31720fea6ca"
            }]
        },
        "version": "4.2-r88003"
    }
},

Creating a plan

Non-barcoded PGM

Post a non-barcoded Target Sequencing PGM plan and to associate results with 2 projects with sampleGrouping and applicationGroup specified:

{
    "autoAnalyze": "true",
    "usePreBeadfind": "true",
    "usePostBeadfind": "true",
    "reverselibrarykey": "",
    "reverse3primeadapter": "",
    "libraryKey": "TCAG",
    "forw ard3primeadapter": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
    "flows": 500,
    "library": "hg19",
    "bedfile": "/results/uploads/BED/71/hg19/unmerged/detail/CFTRexon.20131001.designed.bed",
    "regionfile": "/results/uploads/BED/71/hg19/unmerged/detail/CFTRexon.20131125.hotspots.bed",
    "planName": "DEMO-TS4_2_x-REST- API_TARS_plan1",
    "sample": "my_sample",
    "notes": "this is a REST test plan",
    "username": "ionuser",
    "preAnalysis": "on",
    "isReverseRun": false,
    "isPlanGroup": false,
    "runMode": "single",
    "runType": "TARS",
    "chipType": "318v2",
    "sequencekitname": "IonPGM200Kit",
    "librarykitname": "Ion Xpress Plus Fragment Library Kit",
    "templatingKitName": "Ion PGM Template OT2 200 Kit",
    "samplePrepKitName": "Ion TargetSeq(tm) Custom Enrichment Kit (100kb-500kb)",
    "projects": ["myProject1", "myProject2"],
    "sampleGroupingName": "Self",
    "applicationGroupDisplayedName": "DNA"
}

Non-Barcoded PI

Post a non-barcoded Target Sequencing Proton plan with PI chip, with sample tube label, chip barcode and the QC thresholds specified:

{
    "autoAnalyze": "true",
    "usePreBeadfind": "true",
    "usePostBeadfind": "true",
    "reverselibrarykey": "",
    "reverse3primeadapter": "",
    "libraryKey": "TCAG",
    "forward3primeadapter": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
    "flows": 440,
    "library": "hg19",
    "bedfile": "/results/uploads/BED/14/hg19/unmerged/detail/BRCA1_2.20131001.designed.bed",
    "regionfile": "/results/uploads/BED/14/hg19/unmerged/detail/BRCA1_2.20131001.hotspots.bed",
    "planName": "DEMO-TS4_2_x-REST-API_TARS_Proton_plan2",
    "sample": "my_sample",
    "notes": "here are my notes",
    "username": "ionuser",
    "preAnalysis": "on",
    "isReverseRun": false,
    "isPlanGroup": false,
    "runMode": "single",
    "runType": "TARS",
    "chipType": "P1.1.17",
    "sequencekitname": "ProtonI200Kit-v3",
    "librarykitname": "Ion Xpress Plus Fragment Library Kit",
    "templatingKitName": "Ion PI Template OT2 200 Kit v3",
    "samplePrepKitName": "Ion TargetSeq(tm) Exome Kit (4 rxn)",
    "projects": ["myProject1"],
    "sampleTubeLabel": "abcX254",
    "chipBarcode": "AA02314571",
    "Bead Loading (%)": 33,
    "Key Signal (1-100)": 35,
    "Usable Sequence (%)": 37
}

Barcoded RNA PGM

Post a barcoded RNA Sequencing PGM plan:

{
    "autoAnalyze": "true",
    "usePreBeadfind": "true",
    "usePostBeadfind": "true",
    "reverselibrarykey": "",
    "reverse3primeadapter": "",
    "libraryKey": "TCAG",
    "forward3primeadapter": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
    "flows": 160,
    "library": "hg19_rna",
    "planName": "DEMO-TS4_2_x-REST- API_barcoded_RNA_plan3",
    "notes": "test notes here ",
    "username": "ionuser",
    "preAnalysis": "on",
    "isReverseRun": false,
    "isPlanGroup": false,
    "runMode": "single",
    "runType": "RNA",
    "chipType": "318v2",
    "sequencekitname": "IonPGM200Kit-v2",
    "librarykitname": "Ion Total RNA Seq Kit v2",
    "templatingKitName": "Ion PGM Template OT2 200 Kit",
    "samplePrepKitName": "",
    "projects": ["myProject1", "myProject2"],
    "barcodedSamples": "{'demo sample 1':{'barcodeSampleInfo':{'IonXpressRNA_003':{'controlSequenceType' : 'ERCC Mix 1', 'externalId':'x 1','description':'description here', 'hotSpotRegionBedFile':'', 'nucleotideType': 'RNA', 'reference': 'hg19_rna', 'targetRegionBedFile': ''}},'barcodes':['IonXpressRNA_003']},'demo sample 2':{'barcodeSampleInfo':{'IonXpressRNA_004':{'controlSequenceType' : 'ERCC Mix 2', 'externalId':'x 2','description':'description there', 'hotSpotRegionBedFile':'', 'nucleotideType': 'RNA', 'reference': 'hg19_rna', 'targetRegionBedFile': ''}},'barcodes':['IonXpressRNA_004']}}",
    "applicationGroupDisplayedName": "RNA",
    "barcodeId": "IonXpressRNA",
    "sampleTubeLabel": "2554abc",
    "Bead Loading (%)": 30,
    "Key Signal (1-100)": 30,
    "Usable Sequence (%)": 30
}

Using POST to update a plan

If you are to update a plan via REST API, please perform a GET first so you’ll have all the internally created values for the plan to perform the update with a POST.

To update with a POST, just include “id”: <plan PK> in your data packet (e.g., “id”:1234)

About using PUT or PATCH to update a plan

Update a plan for its chipBarcode value

http://<hostname>/rundb/api/v1/plannedexperiment/<plan pk>/?format=json

{
    "chipBarcode": "AA323323"
}

Fields table

field help text default nullable readonly blank unique type
planDisplayedName Unicode string data. Ex: “Hello World” n/a true false false false string
autoAnalyze Boolean data. Ex: True n/a false false false false boolean
templatingKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
preAnalysis Boolean data. Ex: True   false false true false boolean
chefStatus Unicode string data. Ex: “Hello World”   false false true false string
applicationGroup A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
libkit Unicode string data. Ex: “Hello World” n/a true false false false string
platform Unicode string data. Ex: “Hello World” n/a true true true false string
categories Unicode string data. Ex: “Hello World”   true false false false string
planPGM Unicode string data. Ex: “Hello World” n/a true false false false string
sampleSet_planTotal Integer data. Ex: 2673 0 false false false false integer
projects Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
notes Unicode string data. Ex: “Hello World”   true false true false string
sequencekitname Unicode string data. Ex: “Hello World”   true false true false string
base_recalibration_mode Unicode string data. Ex: “Hello World”   true false true false string
storageHost Unicode string data. Ex: “Hello World” n/a true false false false string
expName Unicode string data. Ex: “Hello World”   false false true false string
cycles Integer data. Ex: 2673 n/a true false false false integer
isReverseRun Boolean data. Ex: True false false false true false boolean
storage_options Unicode string data. Ex: “Hello World” A false false false false string
chipType Unicode string data. Ex: “Hello World”   false false false false string
chefProgress Floating point numeric data. Ex: 26.73 0 false false true false float
library Unicode string data. Ex: “Hello World”   true false true false string
reverselibrarykey Unicode string data. Ex: “Hello World”   false true false false string
sampleTubeLabel Unicode string data. Ex: “Hello World” n/a true false false false string
seqKitBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
barcodeId Unicode string data. Ex: “Hello World”   true false true false string
chefLogPath Unicode string data. Ex: “Hello World” n/a true false true false string
isPlanGroup Boolean data. Ex: True false false false true false boolean
realign Boolean data. Ex: True n/a false false false false boolean
sampleGroupingName Unicode string data. Ex: “Hello World” n/a true true true false string
experiment A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
bedfile Unicode string data. Ex: “Hello World”   false false true false string
isReusable Boolean data. Ex: True false false false true false boolean
isDuplicateReads Boolean data. Ex: True n/a false false false false boolean
librarykitname Unicode string data. Ex: “Hello World”   true false true false string
adapter Unicode string data. Ex: “Hello World” n/a true false false false string
tfKey Unicode string data. Ex: “Hello World”   false false true false string
parentPlan Unicode string data. Ex: “Hello World” None false false true false string
forward3primeadapter Unicode string data. Ex: “Hello World”   true false true false string
samplePrepKitName Unicode string data. Ex: “Hello World” n/a true false false false string
applicationGroupDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
metaData Unicode string data. Ex: “Hello World” {} false false true false string
sampleSet_uid Unicode string data. Ex: “Hello World” n/a true false false false string
isFavorite Boolean data. Ex: True false false false true false boolean
sampleSet_planIndex Integer data. Ex: 2673 0 false false false false integer
qcValues Many related resources. Can be either a list of URIs or list of individually nested resource data. n/a true false true false related
planStatus Unicode string data. Ex: “Hello World”   false false true false string
templatingKitName Unicode string data. Ex: “Hello World” n/a true false false false string
runType Unicode string data. Ex: “Hello World” GENS false false false false string
username Unicode string data. Ex: “Hello World” n/a true false false false string
planName Unicode string data. Ex: “Hello World” n/a true false false false string
sampleDisplayedName Unicode string data. Ex: “Hello World”   true false true false string
controlSequencekitname Unicode string data. Ex: “Hello World” n/a true false false false string
chefMessage Unicode string data. Ex: “Hello World”   false false true false string
templatingSize Unicode string data. Ex: “Hello World”   true false false false string
childPlans A list of data. Ex: [‘abc’, 26.73, 8] [] false false false false list
pairedEndLibraryAdapterName Unicode string data. Ex: “Hello World” n/a true false false false string
runMode Unicode string data. Ex: “Hello World”   false false true false string
irworkflow Unicode string data. Ex: “Hello World”   false false true false string
planExecuted Boolean data. Ex: True false false false true false boolean
project Unicode string data. Ex: “Hello World” n/a false true true false string
usePostBeadfind Boolean data. Ex: True   false false true false boolean
libraryReadLength Integer data. Ex: 2673 0 false false false false integer
runname Unicode string data. Ex: “Hello World” n/a true false false false string
planGUID Unicode string data. Ex: “Hello World” n/a true false false false string
planShortID Unicode string data. Ex: “Hello World” n/a true false false false string
sampleSetGroupType Unicode string data. Ex: “Hello World” n/a true true true false string
sample Unicode string data. Ex: “Hello World”   true false true false string
planExecutedDate A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
reverse_primer Unicode string data. Ex: “Hello World” n/a true false false false string
id Integer data. Ex: 2673   false false true true integer
barcodedSamples Unicode string data. Ex: “Hello World”   true false true false string
regionfile Unicode string data. Ex: “Hello World”   false false true false string
selectedPlugins Unicode string data. Ex: “Hello World”   true false true false string
sampleSet A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
isSystemDefault Boolean data. Ex: True false false false true false boolean
autoName Unicode string data. Ex: “Hello World” n/a true false false false string
libraryKey Unicode string data. Ex: “Hello World”   false false true false string
flows Integer data. Ex: 2673 0 false false false false integer
date A date & time as a string. Ex: “2010-11-10T03:07:43” n/a true false false false datetime
isSystem Boolean data. Ex: True false false false true false boolean
variantfrequency Unicode string data. Ex: “Hello World”   false true false false string
sampleSetDisplayedName Unicode string data. Ex: “Hello World” n/a true true true false string
flowsInOrder Unicode string data. Ex: “Hello World”   true false true false string
sampleGrouping A single related resource. Can be either a URI or set of nested resource data. n/a true false true false related
chipBarcode Unicode string data. Ex: “Hello World” n/a true false false false string
usePreBeadfind Boolean data. Ex: True   false false true false boolean
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
reverse3primeadapter Unicode string data. Ex: “Hello World”   false true false false string

Example request

Request URL: http://mytorrentserver/rundb/api/v1/plannedexperiment/?format=json&limit=1

Python example

import requests

ts_api_request = requests.get("http://mytorrentserver/rundb/api/v1/plannedexperiment/", params={"format": "json", "limit": 1})
ts_api_response = ts_api_request.json()

plannedexperiments = ts_api_response["objects"]

for plannedexperiment in plannedexperiments:
    print plannedexperiment

Torrent Server response

{
    "meta": {
        "previous": null,
        "total_count": 24558,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/plannedexperiment/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "planDisplayedName": "CopyOfSystemDefault_R_2015_02_02_17_43_41_user_GT1-126",
            "autoAnalyze": false,
            "templatingKitBarcode": null,
            "preAnalysis": true,
            "chefStatus": "",
            "applicationGroup": "/rundb/api/v1/applicationgroup/1/",
            "libkit": null,
            "platform": "PROTON",
            "categories": "",
            "planPGM": null,
            "prebasecallerargs": "BaseCaller --barcode-filter 0.01 --barcode-filter-minreads 10 --disable-all-filters on --phasing-residual-filter=2.0 --num-unfiltered 1000",
            "alignmentargs": "stage1 map4",
            "thumbnailbasecallerargs": "BaseCaller --barcode-filter 0.01 --barcode-filter-minreads 10 --barcode-bam-tag --disable-all-filters on --phasing-residual-filter=2.0 --num-unfiltered 100000",
            "sampleSet_planTotal": 0,
            "projects": [],
            "notes": "",
            "sequencekitname": "ProtonI200Kit-v3",
            "base_recalibration_mode": "standard_recal",
            "storageHost": null,
            "expName": "R_2015_02_02_17_43_41_user_GT1-126",
            "cycles": null,
            "isReverseRun": false,
            "storage_options": "A",
            "thumbnailalignmentargs": "stage1 map4",
            "chipType": "P2.2.1",
            "chefProgress": 0,
            "library": "hg19",
            "reverselibrarykey": "",
            "sampleTubeLabel": null,
            "seqKitBarcode": null,
            "barcodeId": "",
            "chefLogPath": null,
            "isPlanGroup": false,
            "realign": false,
            "sampleGroupingName": "",
            "experiment": "/rundb/api/v1/experiment/33090/",
            "bedfile": "",
            "isReusable": false,
            "isDuplicateReads": false,
            "thumbnailbeadfindargs": "justBeadFind --beadfind-minlivesnr 3 --region-size=100,100 --beadfind-thumbnail 1 --beadfind-diagnostics 2",
            "librarykitname": "Ion Xpress Plus Fragment Library Kit",
            "adapter": null,
            "basecallerargs": "BaseCaller --barcode-filter 0.01 --barcode-filter-minreads 10 --disable-all-filters on --phasing-residual-filter=2.0 --num-unfiltered 1000 --barcode-filter-postpone 1 --barcode-bam-tag",
            "tfKey": "ATCG",
            "parentPlan": null,
            "forward3primeadapter": "ATCACCGACTGCCCATAGAGAGGCTGAGAC",
            "planStatus": "run",
            "samplePrepKitName": null,
            "applicationGroupDisplayedName": "DNA",
            "metaData": {},
            "sampleSet_uid": null,
            "isFavorite": false,
            "sampleSet_planIndex": 0,
            "qcValues": [
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/111327/",
                    "id": 289776,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Bead Loading (%)",
                        "id": 1,
                        "resource_uri": "/rundb/api/v1/qctype/1/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/289776/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/111327/",
                    "id": 289775,
                    "qcType": {
                        "description": "",
                        "minThreshold": 1,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Key Signal (1-100)",
                        "id": 2,
                        "resource_uri": "/rundb/api/v1/qctype/2/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/289775/"
                },
                {
                    "threshold": 30,
                    "plannedExperiment": "/rundb/api/v1/plannedexperiment/111327/",
                    "id": 289774,
                    "qcType": {
                        "description": "",
                        "minThreshold": 0,
                        "maxThreshold": 100,
                        "defaultThreshold": 30,
                        "qcName": "Usable Sequence (%)",
                        "id": 3,
                        "resource_uri": "/rundb/api/v1/qctype/3/"
                    },
                    "resource_uri": "/rundb/api/v1/plannedexperimentqc/289774/"
                }
            ],
            "analysisargs": "Analysis --from-beadfind --clonal-filter-bkgmodel false --region-size=216,224 --bkg-bfmask-update false --gpuWorkLoad 1 --total-timeout 600 --bkg-well-xtalk-name /opt/ion/config/xtalk.p2.2.1.settings.20140120.json",
            "thumbnailcalibrateargs": "calibrate --skipDroop",
            "templatingKitName": "Ion PI Template OT2 200 Kit v3",
            "runType": "GENS",
            "username": null,
            "planName": "CopyOfSystemDefault_R_2015_02_02_17_43_41_user_GT1-126",
            "sampleDisplayedName": "",
            "prethumbnailbasecallerargs": "BaseCaller --barcode-filter 0.01 --barcode-filter-minreads 10 --disable-all-filters on --phasing-residual-filter=2.0 --num-unfiltered 100000",
            "controlSequencekitname": null,
            "chefMessage": "",
            "templatingSize": "",
            "childPlans": [],
            "pairedEndLibraryAdapterName": null,
            "runMode": "single",
            "irworkflow": "",
            "planExecuted": true,
            "project": "",
            "usePostBeadfind": false,
            "libraryReadLength": 0,
            "runname": null,
            "planGUID": "8aad7839-ccf2-46c2-9158-4f76b8b6d491",
            "planShortID": "G76FR",
            "sampleSetGroupType": null,
            "sample": "",
            "planExecutedDate": null,
            "reverse_primer": null,
            "id": 111327,
            "barcodedSamples": {},
            "regionfile": "",
            "selectedPlugins": {},
            "beadfindargs": "justBeadFind --beadfind-minlivesnr 3 --region-size=216,224 --total-timeout 600",
            "sampleSet": null,
            "isSystemDefault": false,
            "autoName": null,
            "libraryKey": "TCAG",
            "flows": 60,
            "thumbnailanalysisargs": "Analysis --from-beadfind --clonal-filter-bkgmodel false --region-size=100,100 --bkg-bfmask-update false --gpuWorkLoad 1 --bkg-debug-param 0 --beadfind-thumbnail 1 --bkg-debug-files --bkg-well-xtalk-name /opt/ion/config/xtalk.p2.2.1.settings.20140120.json",
            "date": "2015-02-02T22:44:33.000729+00:00",
            "isSystem": false,
            "variantfrequency": "",
            "sampleSetDisplayedName": "",
            "calibrateargs": "calibrate --skipDroop",
            "flowsInOrder": "TACGTACGTCTGAGCATCGATCGATGTACAGC",
            "sampleGrouping": null,
            "chipBarcode": null,
            "usePreBeadfind": true,
            "resource_uri": "/rundb/api/v1/plannedexperiment/111327/",
            "reverse3primeadapter": ""
        }
    ]
}

Allowed HTTP methods

  • get
  • post
  • put
  • delete
  • patch