Tfmetrics Resource

Resource URL: http://mytorrentserver/rundb/api/v1/tfmetrics/

Schema URL: http://mytorrentserver/rundb/api/v1/tfmetrics/schema/

Perform read-only operations on tfmetrics resources and data elements.

Fields table

field help text default nullable readonly blank unique type
corrHPSNR Unicode string data. Ex: “Hello World”   false false true false string
Q10Mean Floating point numeric data. Ex: 26.73 n/a false false false false float
SysSNR Floating point numeric data. Ex: 26.73 n/a false false false false float
HPAccuracy Unicode string data. Ex: “Hello World”   false false true false string
Q17ReadCount Floating point numeric data. Ex: 26.73 n/a false false false false float
sequence Unicode string data. Ex: “Hello World” n/a false false false false string
Q17Histo Unicode string data. Ex: “Hello World”   false false true false string
name Unicode string data. Ex: “Hello World” n/a false false false false string
aveKeyCount Floating point numeric data. Ex: 26.73 n/a false false false false float
number Floating point numeric data. Ex: 26.73 n/a false false false false float
id Integer data. Ex: 2673   false false true true integer
keypass Floating point numeric data. Ex: 26.73 n/a false false false false float
Q10ReadCount Floating point numeric data. Ex: 26.73 n/a false false false false float
report A single related resource. Can be either a URI or set of nested resource data. n/a false false false false related
resource_uri Unicode string data. Ex: “Hello World” n/a false true false false string
Q17Mean Floating point numeric data. Ex: 26.73 n/a false false false false float
Q10Histo Unicode string data. Ex: “Hello World”   false false true false string

Example request

Request URL: http://mytorrentserver/rundb/api/v1/tfmetrics/?format=json&limit=1

Python example

import requests

ts_api_request = requests.get("http://mytorrentserver/rundb/api/v1/tfmetrics/", params={"format": "json", "limit": 1})
ts_api_response = ts_api_request.json()

tfmetricss = ts_api_response["objects"]

for tfmetrics in tfmetricss:
    print tfmetrics

Torrent Server response

{
    "meta": {
        "previous": null,
        "total_count": 7320,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/tfmetrics/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "corrHPSNR": "",
            "Q10Mean": 79.7,
            "SysSNR": 20.19,
            "HPAccuracy": "0 : 560244/582614, 1 : 356550/377171, 2 : 35115/45374, 3 : 0/0, 4 : 521/4373, 5 : 0/0, 6 : 0/0, 7 : 0/0",
            "Q17ReadCount": 3992.0,
            "sequence": "TTGCGCGCGCTGTGAATGCGCTGCTGTCGAATCGCGCTGCGCTGAACGTCGCGTGCGCGAACGATCTGAGACTGCCAAGGCACACAGGGGATAGG",
            "Q17Histo": "951 0 0 1 9 5 2 7 6 277 5 0 1 2 3 0 2 1 6 1 7 2 3 3 0 0 10 1 0 26 0 2 0 1 2 3 5 1 1 0 2 6 2 1 9 0 3 5 2 0 7 0 2 5 4 2 6 2 34 4 13 1 15 5 18 7 8 6 12 7 9 12 1 9 1 44 0 67 0 29 2 37 7 3 6 305 356 544 0 35 14 1116 1019 52 150 16 0 0 0 0 0",
            "name": "TF_D",
            "aveKeyCount": 71.0,
            "number": 4119.0,
            "id": 1,
            "keypass": 5368.0,
            "Q10ReadCount": 4586.0,
            "report": "/rundb/api/v1/results/89/",
            "resource_uri": "/rundb/api/v1/tfmetrics/1/",
            "Q17Mean": 66.56,
            "Q10Histo": "40 0 0 1 8 3 0 4 2 1 587 5 3 5 1 8 0 2 6 1 5 1 3 3 2 1 5 9 0 0 2 0 2 1 5 1 0 4 0 2 5 8 7 7 5 2 5 8 9 3 5 3 1 5 1 1 2 4 4 1 1 2 4 5 5 4 4 21 6 1 5 14 9 13 3 1 1 2 15 10 25 18 36 18 20 18 40 78 138 109 95 399 1340 1471 383 245 0 0 0 0 0"
        }
    ]
}

Allowed HTTP methods

  • get
  • post
  • put
  • delete
  • patch

Table of contents

Previous topic

Template Resource

Next topic

Threeprimeadapter Resource

This Page