Tfmetrics Resource

Resource URL: http://mytorrentserver/rundb/api/v1/tfmetrics/

Schema URL: http://mytorrentserver/rundb/api/v1/tfmetrics/schema/

Perform read-only operations on tfmetrics resources and data elements.

Fields table

field	help text	default	nullable	readonly	blank	unique	type
corrHPSNR	Unicode string data. Ex: “Hello World”		false	false	true	false	string
Q10Mean	Floating point numeric data. Ex: 26.73	n/a	false	false	false	false	float
SysSNR	Floating point numeric data. Ex: 26.73	n/a	false	false	false	false	float
HPAccuracy	Unicode string data. Ex: “Hello World”		false	false	true	false	string
Q17ReadCount	Floating point numeric data. Ex: 26.73	n/a	false	false	false	false	float
sequence	Unicode string data. Ex: “Hello World”	n/a	false	false	false	false	string
Q17Histo	Unicode string data. Ex: “Hello World”		false	false	true	false	string
name	Unicode string data. Ex: “Hello World”	n/a	false	false	false	false	string
aveKeyCount	Floating point numeric data. Ex: 26.73	n/a	false	false	false	false	float
number	Floating point numeric data. Ex: 26.73	n/a	false	false	false	false	float
id	Integer data. Ex: 2673		false	false	true	true	integer
keypass	Floating point numeric data. Ex: 26.73	n/a	false	false	false	false	float
Q10ReadCount	Floating point numeric data. Ex: 26.73	n/a	false	false	false	false	float
report	A single related resource. Can be either a URI or set of nested resource data.	n/a	false	false	false	false	related
resource_uri	Unicode string data. Ex: “Hello World”	n/a	false	true	false	false	string
Q17Mean	Floating point numeric data. Ex: 26.73	n/a	false	false	false	false	float
Q10Histo	Unicode string data. Ex: “Hello World”		false	false	true	false	string

Example request

Request URL: http://mytorrentserver/rundb/api/v1/tfmetrics/?format=json&limit=1

Python example

import requests

ts_api_request = requests.get("http://mytorrentserver/rundb/api/v1/tfmetrics/", params={"format": "json", "limit": 1})
ts_api_response = ts_api_request.json()

tfmetricss = ts_api_response["objects"]

for tfmetrics in tfmetricss:
    print tfmetrics

Torrent Server response

{
    "meta": {
        "previous": null,
        "total_count": 20435,
        "offset": 0,
        "limit": 1,
        "next": "/rundb/api/v1/tfmetrics/?offset=1&limit=1&format=json"
    },
    "objects": [
        {
            "corrHPSNR": "",
            "Q10Mean": 41.6,
            "SysSNR": 3.46,
            "HPAccuracy": "0 : 137931/168077, 1 : 135718/167266, 2 : 2833/7002, 3 : 199/2918, 4 : 0/0, 5 : 0/0, 6 : 0/0, 7 : 0/0",
            "Q17ReadCount": 450.0,
            "sequence": "TAGCGTACATCGCGCATCTATATATCGTCAACTACGCTGAGTCGGAGACACGCAGGGATGAGATGG",
            "Q17Histo": "71 30 30 12 56 15 13 0 9 38 19 21 16 9 85 28 110 6 34 15 118 27 79 22 57 45 97 23 224 560 0 41 11 72 103 3 62 6 21 13 19 4 50 216 0 54 16 12 1 4 67 95 71 142 20 17 10 3 5 2 4 5 1 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0",
            "name": "TF5",
            "aveKeyCount": 0.0,
            "number": 3024.0,
            "id": 1,
            "keypass": 3027.0,
            "Q10ReadCount": 1285.0,
            "report": "/rundb/api/v1/results/2/",
            "resource_uri": "/rundb/api/v1/tfmetrics/1/",
            "Q17Mean": 29.95,
            "Q10Histo": "33 16 20 7 1 0 10 0 4 0 2 1 5 20 21 85 18 6 73 0 9 9 37 35 144 28 20 29 88 14 84 14 147 38 6 70 39 20 77 11 34 33 34 64 42 45 74 65 72 38 134 122 110 106 118 126 101 94 17 11 25 38 51 45 55 38 94 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0"
        }
    ]
}

Allowed HTTP methods

• get
• post
• put
• delete
• patch